Mi.49-SELENOH-1-U

General Information

Protein ID
951 
External ID
 

Protein Information

Protein Name
Mi.49-SELENOH-1-U 
Family
SELENOH 
Species
Micromonas sp. CCMP490 
Genome
 
EST
gi|110151647|gb|EC845050.1|EC845050 
Functional Domain
HTML
Function
 

Sequence

Orientation
Forward 
Nucleotide Sequence
ATGTCCACTGTTCCCCCGAACGCGGTGTACATCGAGGCGTGCAAGTCCTGACAAGCGTTCAAGAAACGCGCTGAGTCTATCAGCGCGTACGTGTTGAAACACGCACCG 
Protein Sequence
MSTVPPNAVYIEACKSUQAFKKRAESISAYVLKHAP 
SECIS Sequence
 

Structure Picture