1_Bi.na_SELENOH_E

General Information

Protein ID
614 
External ID
 

Protein Information

Protein Name
1_Bi.na_SELENOH_E 
Family
SELENOH 
Species
Bigelowiella natans 
Genome
 
EST
gi|66860878|gb|DR040393.1|DR040393 
Functional Domain
 
Function
 

Sequence

Orientation
Forward 
Nucleotide Sequence
ATGCCGAAAACAGTCAATCGCGTAGCCGCCTCTGAATGGGGCAAGAAGTTGAAGGGAGTTGCCATCGAAGCGTGCACTAGCTGAGGCGCGTTCAAATCACGAGCCAACAAGTTGTTGAAGCTCGTGAAGGGCCAGGTGAAGGGCGCTACTGTTGCGATCAACACAGAGAGGCCTCGGAAAGGGACCTTTCAAGTTGTCGTCAATGGGGAGACGCTGCTAAGCCTTGAAGCGATGGCGCGACCATTCTCTAAGCTCAAGGGAACGAATATTGAGGATTTGGCTGAGAAAGTCGTGGAGAAGCTTGAAGGAGGAGGCGGTGGGAGCAAAGCGAAGGGTGTCGCTCCTGAGAAGAAATCGACTAAGAAGACCAAGGAGTCGAAATCCAAAACAGCCTCGCAAAAGAGCAGCAAAGCGACAGCAAAAGCGGCGACGAAGGCCGCAGCGAAGAAGGCTCCTGCCGCCAAACGGAAGGCGCCCGCACCAACGGTAGGCGTCCGTCGCTCGAGCCGTATCAGGACTCAAAAGTAA 
Protein Sequence
MPKTVNRVAASEWGKKLKGVAIEACTSUGAFKSRANKLLKLVKGQVKGATVAINTERPRKGTFQVVVNGETLLSLEAMARPFSKLKGTNIEDLAEKVVEKLEGGGGGSKAKGVAPEKKSTKKTKESKSKTASQKSSKATAKAATKAAAKKAPAAKRKAPAPTVGVRRSSRIRTQK* 
SECIS Sequence
 

Structure Picture