Au.an-SELENOT-1-U

General Information

Protein ID
558 
External ID
 

Protein Information

Protein Name
Au.an-SELENOT-1-U 
Family
SELENOT 
Species
Aureococcus anophagefferens 
Genome
ACJI01002552 
EST
gi|161687645|gb|FC045718.1|FC045718,gi|161665903|gb|FC019247.1|FC019247,gi|161694479|gb|FC051544.1|FC051544,gi|161692326|gb|FC043197.1|FC043197,gi|161650897|gb|FC009529.1|FC009529 
Functional Domain
HTML
Function
 

Sequence

Orientation
Forward 
Nucleotide Sequence
GCCGGCGCCGCCCGCGGCGGCGGGCGCGGCCTTCGCGGGCGACGCCGGCGGCCCCGCGGCCCGGGGCCGGGGCCTCGCGGGCGCGGACCGCGACGCCGCCGACGAGGAGTTCGCCGAGTTCGCGCCGCCGGCCGCGGCCGCGCGCGCGGCGCCGGCCGCGGCGGCGCCCGTCGCGGCCGCGAAGCGCGCGGCGCCGGCCGCGGGCGGCGCCCGGGCCAACGGCGACGCCGAGGTGCTCGTCAAGCTCTGCACGAGCTGAGGCACGCAGAGGAACTACCTCGAGCTGAGGAAGTTCCTCGAAGACGCGTACCCCGGCCTCCGGTCCGTCGCGGCCGAGCAGTACCCGCCGCCGGCCGTCGGCGTGTTCGCGGCGCAGGCCGCGGGCATGGCCCAGGTCGCCTGCGTGGCGCTGCTCCTCGGCGGCGAGAAGGTCTTCCAGCTCTTCGGCGCGGCGACGCCGGGCTGGTACCACTCCGTCGCGGAGAACAAGATGATGGCCTTTGGGGCCGTCTGGATGGCGAACAACGTCGCGGCCCAGATGGTCGCGACGGGCGCCTTCGAGATCCACGTCAACGGCGAGCTCGCCTTCTCCAAGCTCGAGACGGGCCGCCTGCCGTCCGCGGCGGACGTCGTCCGCGGCATGAAGCGCGCCGGCTTCGCCACGGACCTCGAGGCCCGCTACGTCGGCGACGCCGAGTTCTAG 
Protein Sequence
PAPPAAAGAAFAGDAGGPAARGRGLAGADRDAADEEFAEFAPPAAAARAAPAAAAPVAAAKRAAPAAGGARANGDAEVLVKLCTSUGTQRNYLELRKFLEDAYPGLRSVAAEQYPPPAVGVFAAQAAGMAQVACVALLLGGEKVFQLFGAATPGWYHSVAENKMMAFGAVWMANNVAAQMVATGAFEIHVNGELAFSKLETGRLPSAADVVRGMKRAGFATDLEARYVGDAEF* 
SECIS Sequence
APVAAAKRAAPAAGGARANGDAEVLVKLCTSUGTQRNYLELRKFLEDAYPGLRSVAAEQYPPPAVGVFAAQAAGMAQVACVALLLGGEKVFQLFGAATPGWYHSVAENKMMAFGAVWMANNVAAQMVATGAFEIHVNGELAFSKLETGRLPSAADVVRGMKRAGFATDLEARYVGDAEF 

Structure Picture