Pi.sp-SELENOT-1-U

General Information

Protein ID
518 
External ID
 

Protein Information

Protein Name
Pi.sp-SELENOT-1-U 
Family
SELENOT 
Species
Picochlorum sp. SENEW3 
Genome
JPID01000089 
EST
 
Functional Domain
HTML
Function
 

Sequence

Orientation
Reverse 
Nucleotide Sequence
CGGATTTTGTTACAATTCTGTAAAAGTTGATCCTACAGAGGTGCTGCGATGCAGGTTCAACAGTATCTGAGGCAGCACCTAGGACCTGAAAATATAGACTTTGTCATGGAGAATTACCCCCCGACTCCGACGAATGCATTCCTGTCTAAAATTGTGACGATGATTCAGATGGGAGTGATGGGTGCGGCGTTGCTGATGGATCAGTTGGGTAATGCTCTGAACATCACCATTCCTCCAGAGGTGAAGGAGAAGAAGATGATGATACTAATGGGGGCATGGTTCATTGGTAATACAGTGAATAATGCCCTGACCTCGACGGGCGCGTTTGAAATTTATTTTGACAATTCGTTGGTGTTCAGTAAACTTGCGACAGGACGCATGCCTAGTAATATGGAGGAGATTTTGAGGGGGATTGAGCAAATTATGGGCAAATCCCAG 
Protein Sequence
RILLQFCKSUSYRGAAMQVQQYLRQHLGPENIDFVMENYPPTPTNAFLSKIVTMIQMGVMGAALLMDQLGNALNITIPPEVKEKKMMILMGAWFIGNTVNNALTSTGAFEIYFDNSLVFSKLATGRMPSNMEEILRGIEQIMGKSQ 
SECIS Sequence
GGUGACCCGAGUUAUCAUUCAAAACGCAGUGUGAGUGAUGGUACUGAAGAUGCCGUCCUUGUUAGUCUGUAAUCAAGAAGAAGGUGUACCGAGCUUUGC 

Structure Picture