Pr.pa-SELENOM-1-U

General Information

Protein ID
185 
External ID
 

Protein Information

Protein Name
Pr.pa-SELENOM-1-U 
Family
SELENOM 
Species
Prymnesium parvum 
Genome
 
EST
gi|383203837|gb|HE784668.1|HE784668 
Functional Domain
HTML
Function
 

Sequence

Orientation
Forward 
Nucleotide Sequence
ATGGTCTGCGACAACGAGAAGGCGCGGCTCCACCACGCCGAGCTCCGCACGTGCTCTGGCTGACGTCTGAATCAGTTCCCGGAGCTCGCCCAGTTTGTGCGCGAAGATGGACAAGCTGACAGGTACTCCAACCTTCGCATCAACTATGTCGACCACCACAACCCAGATCTGATACTATTTGACGAGAGGAACAACGAGCTGCACCGCATTGACCTCACACGGCTGCGCACTCTGGAGAGCATGCACAAGCTCATGGTGCTTCTGGGGCTGCGCGAAATCTGCAGAGATGTGAATCCGACCTGTGCGGAATGGGCAGCCAGTGGCGAATGTGAGAACAACTACGTGTATATGACGCATGCCTGCAGGAAGGCTTGCAATGTTTGTGGCGTGAACGCGGCGACTGAGGACGTTCCAGCGTGCAGAGATGTGTCTCTAGAGCATGATTGCCAATACTGGTCGACGATGGGTCAATGCGACGAAAATCCTGGGTTCATGCGCGTGAATTGTGCAAAGTCGTGTGGGATCTGCACAACTGTCGCTGGCATCGACGAGGATGCATTGCGATTGGACAAAGATGAGCTGTAG 
Protein Sequence
MVCDNEKARLHHAELRTCSGURLNQFPELAQFVREDGQADRYSNLRINYVDHHNPDLILFDERNNELHRIDLTRLRTLESMHKLMVLLGLREICRDVNPTCAEWAASGECENNYVYMTHACRKACNVCGVNAATEDVPACRDVSLEHDCQYWSTMGQCDENPGFMRVNCAKSCGICTTVAGIDEDALRLDKDEL* 
SECIS Sequence
 

Structure Picture