Sy.mi-MSRA-2-U

General Information

Protein ID
100 
External ID
 

Protein Information

Protein Name
Sy.mi-MSRA-2-U 
Family
MSRA 
Species
Symbiodinium minutum 
Genome
DF243932 
EST
 
Functional Domain
HTML
Function
 

Sequence

Orientation
Reverse 
Nucleotide Sequence
GGCTGATTCTGGACACCACAACGTTTGTTCACCCAAGTCTCTGGCGTTCATCGAGCCACTGCAGGATATACTGGTGGCAGGCGGGAGGCAAGAAATCAT 
Protein Sequence
GUFWTPQRLFTQVSGVHRATAGYTGGRREARNH 
SECIS Sequence
ACAUCUUGGAGAUGUUGAAAUGUCACAGGGUGAGGGUGGUUGAGCCAGUGCAGAGGCAGUUCGCCGGAGAGCGUGGACGAGAUAGAGACAACC 

Structure Picture